Re: Adding auto-numbered field screws up Table order

Tech-Archive recommends: Repair Windows Errors & Optimize Windows Performance

From: Steve Schapel (schapel_at_mvps.org.ns)
Date: 05/30/04 

Date: Sun, 30 May 2004 14:25:48 +1200

John,

If you read my responses carefully, I think you will find that, as is
our wont, we are in perfect agreement on all points. ;-) 

-- 
Steve Schapel, Microsoft Access MVP
John Vinson wrote:
> Part of the problem (and I'm treading on thin ice here, disagreeing
> with Steve!) is that you're assuming that a table HAS an order. It
> doesn't. It's an unordered "Bag" of data! Tables will often be
> presented for view in sequential order of the table's Primary Key, but
> if you use a Query joining this table to some other table, or use the
> table as the recordsource of a Report, or a variety of other uses,
> you'll see the records in whatever sequence the query optimizer finds
> most efficient.
> 
> If you want to sort records in a particular order you must - no
> option! - use a Query rather than a table, and the Query must have an
> Order By clause sorting the records by specified fields in the table;
> or you must set the Order By property of a Form, or the Sorting and
> Grouping property of a Report to control the sequence. You *cannot*
> count on a table having ANY predictable order.
> 
>                   John W. Vinson[MVP]    
>     Come for live chats every Tuesday and Thursday 
> http://go.compuserve.com/msdevapps?loc=us&access=public

Relevant Pages

  • Re: Adding auto-numbered field screws up Table order
    ... >autonumbered field. ... if you use a Query joining this table to some other table, ... Grouping property of a Report to control the sequence. ...
    (microsoft.public.access.tablesdbdesign)
  • Re: Gaps in ordered series
    ... The queries presuppose a table named [Sequence] with a single numeric field ... First query, named: ... Second query, named: ...
    (microsoft.public.access.queries)
  • RE: Filtering a subform using many combo boxes
    ... "Steve Sanford" wrote: ... SELECT AssignedPriority, AssignedPriorityDetail FROM tblAssignedPriority ... I followed you instructions to the letter and every one of the criteria ... open the query "qryProjects" in design view. ...
    (microsoft.public.access.forms)
  • Re: Spin calling John 100% identity (Human & Gekko)
    ... Unfortunately there are no other sequences to use in checking the accuracy of that EST, i.e. no Gekko atpase sequences, and the study the sequence comes from is unpublished. ... Query 4427 ... Sbjct 6 ... TCTGACATGGGGCCACCCCACAGGTCAGAGTGGTGGTAGAACCCCTTCAGGACTCCCAGC 245 ...
    (talk.origins)
  • Re: query for multiple results
    ... SELECT yourFields from yourTable WHERE ... Steve D ... "Tom Ellison" wrote: ... When i run the query, the parameter query dialog box opens. ...
    (microsoft.public.access.queries)