Re: Turn off Auto Fill In???

Tech-Archive recommends: Repair Windows Errors & Optimize Windows Performance



"John Vinson" <jvinson@xxxxxxxxxxxxxxxxxxxxxxxxxx> wrote in message
news:pibb929vfo8nkl5dcmo72t1b2g0tceomsa@xxxxxxxxxx
On Sun, 18 Jun 2006 19:33:07 GMT, "Doug in Texas"
<douglarsonNOSPAM@xxxxxxxxxxxxx> wrote:

If I enter a sequence of numbers in 2 or more consecutive records, I get
an
auto fill that enters the next records number in the sequence
automatically.

This is a VERY annoying misfeature introduced in Access2000 by someone
who mistakenly thought that Access tables should work like Excel
spreadsheets.

There's no way to turn it off; but what you can do is base a continous
Form on the table (or on a query based on the table). A continuous
Form doesn't have this obnoxious behavior but will let you update the
data.

John W. Vinson[MVP]

It would be a useful feature in some circumstances, but for my purposes,
it's become a bothersome nusance. Thanks for the work-around.

DougInTexas



.

Relevant Pages

  • Re: Sequencing parts
    ... sequence source for the query to do it ... then the below query i have named it autonumberfield ... the below query then takes the auto number field and uses it to ... records on the screen a database can only see 1 and i say again 1!!! ...
    (microsoft.public.access.queries)
  • Re: How do I update a field in Microsoft Access with the RowID of reco
    ... don't want use auto number in the table as I would only like to populate the ... rows in the table which have been extracted by the query. ... or the underlying data can and will change the sequence and number of ...
    (microsoft.public.access.queries)
  • Re: Turn off Auto Fill In???
    ... auto fill that enters the next records number in the sequence automatically. ... spreadsheets. ... Form on the table (or on a query based on the table). ... Form doesn't have this obnoxious behavior but will let you update the ...
    (microsoft.public.access.queries)
  • Re: Gaps in ordered series
    ... The queries presuppose a table named [Sequence] with a single numeric field ... First query, named: ... Second query, named: ...
    (microsoft.public.access.queries)
  • Re: Spin calling John 100% identity (Human & Gekko)
    ... Unfortunately there are no other sequences to use in checking the accuracy of that EST, i.e. no Gekko atpase sequences, and the study the sequence comes from is unpublished. ... Query 4427 ... Sbjct 6 ... TCTGACATGGGGCCACCCCACAGGTCAGAGTGGTGGTAGAACCCCTTCAGGACTCCCAGC 245 ...
    (talk.origins)