Re: query unique count for field

Tech-Archive recommends: Repair Windows Errors & Optimize Windows Performance



Hi,



"Lancslad" <Lancslad@xxxxxxxxxxxxxxxxxxxxxxxxx> wrote in message
news:FD16967C-2B2E-43FF-BF89-039E122DEA6E@xxxxxxxxxxxxxxxx
> I'm afraid I'm still struggling with this. From your valuable help, I now
> have a table of records, then a grouping of those records, and then a
> query
> with the same number of records as the first table, but with sequential
> numbers for each group. I am trying to apply this new grouped sequence to
> the
> first set of records. I am not looking for a 1 to n sequence across the
> whole
> set, but the sequence must reset at the satart if each group.
>


You have it right up to that point. From there, you stop to follow the
suggestion I made, it seems.

If your temp table is like:

auto f1 f2
1 Utah 5050
2 Utah 5051
3 Utah 5052
4 Kansas 10
5 Kansas 22
6 Kansas 27
7 Kansas 32


then query2, see my original post, should return


f1 minGroup
Utah 1
Kansas 4


and the last query would produce:


1+auto-minGroup f1 f2
1 Utah 5050
2 Utah 5051
3 Utah 5052
1 Kansas 10
2 Kansas 22
3 Kansas 27
4 Kansas 32




Hoping it may help,
Vanderghast, Access MVP


.



Relevant Pages

  • Re: query unique count for field
    ... Michel, ... I am trying to apply this new grouped sequence to ... >> first set of records. ... > and the last query would produce: ...
    (microsoft.public.access.queries)
  • Re: Gaps in ordered series
    ... The queries presuppose a table named [Sequence] with a single numeric field ... First query, named: ... Second query, named: ...
    (microsoft.public.access.queries)
  • Re: Spin calling John 100% identity (Human & Gekko)
    ... Unfortunately there are no other sequences to use in checking the accuracy of that EST, i.e. no Gekko atpase sequences, and the study the sequence comes from is unpublished. ... Query 4427 ... Sbjct 6 ... TCTGACATGGGGCCACCCCACAGGTCAGAGTGGTGGTAGAACCCCTTCAGGACTCCCAGC 245 ...
    (talk.origins)
  • Re: Group By Sequential Records
    ... Is there any way to speed up the query? ... in each "sequence" where Group and AltID are the same and ID numbers are ... remains the same throughout each "sequence". ... FROM AddrCent AS Sub ...
    (microsoft.public.access.queries)
  • Re: Doubling the order
    ... 1.PRODUCTID) - primary Key ... > data model or any data integrity. ... the gap in the sequence is not filled in and the sequence ... > Since a query result is a table, and a table is a set which has no ...
    (microsoft.public.sqlserver.programming)